Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 1322296
End position: 1322325
Length: 30

DNA sequence
>NC_020566, from 1322296 to 1322325 (30 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 TATTAAAGAATATGAAATAATAGAAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1321521-1324550	Sequence	SAI5S5_1009630 - Putative Nuclease sbcCD subunit C