Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 1084840
End position: 1084866
Length: 27

DNA sequence
>NC_020566, from 1084840 to 1084866 (27 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1083213-1085150	Sequence	SAI5S5_1007980 isdB Iron-regulated surface determinant protein B (Protein is coded in complementary strand; from 1085150 to 1083213)