Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 1752130
End position: 1752189
Length: 60

DNA sequence
>NC_020558, from 1752130 to 1752189 (60 bp); Listeria monocytogenes N53-1 GCATCCGCATCCGCATCAGCATCGGCGTCGGCATCCGCATCCGCATCGGCATCCGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1751365-1752996	Sequence	BN419_2161 - Mitochondrial import inner membrane translocase subunit TIM50-B (Protein is coded in complementary strand; from 1752996 to 1751365)