Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 1752946
End position: 1752999
Length: 54

DNA sequence
>NC_020558, from 1752946 to 1752999 (54 bp); Listeria monocytogenes N53-1 ATCCGCGTCGGCATCCGCATCAGCGTCGGCGTCAGCATCCGCGTCGGCATCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1751365-1752996	Sequence	BN419_2161 - Mitochondrial import inner membrane translocase subunit TIM50-B (Protein is coded in complementary strand; from 1752996 to 1751365)
ORF... 1752996-1754066	Sequence	BN419_2162 - Proline--tRNA ligase (Protein is coded in complementary strand; from 1754066 to 1752996)