Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 645623
End position: 645662
Length: 40

DNA sequence
>NC_020558, from 645623 to 645662 (40 bp); Listeria monocytogenes N53-1 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 645160-646080	Sequence	BN419_0784 - Motility gene repressor MogR (Protein is coded in complementary strand; from 646080 to 645160)