Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 1537572
End position: 1537607
Length: 36

DNA sequence
>NC_020558, from 1537572 to 1537607 (36 bp); Listeria monocytogenes N53-1 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1537554-1538009	Sequence	BN419_1882 - UPF0478 protein SAOUHSC_01855 (Protein is coded in complementary strand; from 1538009 to 1537554)