Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 2484818
End position: 2484841
Length: 24

DNA sequence
>NC_020558, from 2484818 to 2484841 (24 bp); Listeria monocytogenes N53-1 ATCATCATCATCTTCATCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2484729-2485265	Sequence	BN419_3042 - Probable DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 2485265 to 2484729)