Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 2261210
End position: 2261233
Length: 24

DNA sequence
>NC_020558, from 2261210 to 2261233 (24 bp); Listeria monocytogenes N53-1 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2261101-2261271	Sequence	BN419_2775 - Pseudouridine-5'-phosphate glycosidase (Protein is coded in complementary strand; from 2261271 to 2261101)