Sequence retrieval

Genome: Listeria monocytogenes N53-1
Start position: 1753002
End position: 1753025
Length: 24

DNA sequence
>NC_020558, from 1753002 to 1753025 (24 bp); Listeria monocytogenes N53-1 GCATCAGCATCAGCATCAGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1752996-1754066	Sequence	BN419_2162 - Proline--tRNA ligase (Protein is coded in complementary strand; from 1754066 to 1752996)