Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 817077
End position: 817124
Length: 48

DNA sequence
>NC_020546, from 817077 to 817124 (48 bp); Bifidobacterium thermophilum RBL67 CCGACACCTGATCCGACGCCTGACCCCACGCCTGATCCGACGCCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 815836-818034	Sequence	D805_0646 - Glycoside Hydrolase Family 5 candidate endoglucanase