Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 715765
End position: 715791
Length: 27

DNA sequence
>NC_020546, from 715765 to 715791 (27 bp); Bifidobacterium thermophilum RBL67 TCGTCGAAGTCGTCGAAGTCGTCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 713824-716394	Sequence	D805_0563 - twitching motility protein (Protein is coded in complementary strand; from 716394 to 713824)