Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 705598
End position: 705621
Length: 24

DNA sequence
>NC_020546, from 705598 to 705621 (24 bp); Bifidobacterium thermophilum RBL67 GTCACGGTCACGGTCACGGTCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 705464-705643	Sequence	D805_0556 - hypothetical protein (Protein is coded in complementary strand; from 705643 to 705464)