Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 405218
End position: 405244
Length: 27

DNA sequence
>NC_020546, from 405218 to 405244 (27 bp); Bifidobacterium thermophilum RBL67 CGACGGAACCGCCGGAACCGCCGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 404337-406277	Sequence	D805_0346 - transporter, major facilitator family protein (Protein is coded in complementary strand; from 406277 to 404337)