Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 2283909
End position: 2283935
Length: 27

DNA sequence
>NC_020546, from 2283909 to 2283935 (27 bp); Bifidobacterium thermophilum RBL67 GATGTTTCAGATGTTGCAGATGTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2282655-2284205	Sequence	D805_1839 - chromosome partitioning protein ParB (Protein is coded in complementary strand; from 2284205 to 2282655)