Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 2254545
End position: 2254568
Length: 24

DNA sequence
>NC_020546, from 2254545 to 2254568 (24 bp); Bifidobacterium thermophilum RBL67 ACCGGCACCAGCAGCGGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2253673-2255010	Sequence	D805_1819 - hypothetical protein (Protein is coded in complementary strand; from 2255010 to 2253673)