Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 2079546
End position: 2079593
Length: 48

DNA sequence
>NC_020546, from 2079546 to 2079593 (48 bp); Bifidobacterium thermophilum RBL67 CGGCGGTTCACACCACCGGCGGTTCACACCACCGGCAGCTCACATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2079586-2080371	Sequence	D805_1684 - putative ABC transport system membrane protein (Protein is coded in complementary strand; from 2080371 to 2079586)