Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 2038839
End position: 2038865
Length: 27

DNA sequence
>NC_020546, from 2038839 to 2038865 (27 bp); Bifidobacterium thermophilum RBL67 AGCAGACCAAGGAGACCAAGCCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2037429-2038883	Sequence	D805_1651 - SalY-type ABC antimicrobial peptide transportsystem permease component