Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1844419
End position: 1844448
Length: 30

DNA sequence
>NC_020546, from 1844419 to 1844448 (30 bp); Bifidobacterium thermophilum RBL67 GCCGCCGCCGGCTCCGCCGCCACCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1844402-1846609	Sequence	D805_1509 - hypothetical protein (Protein is coded in complementary strand; from 1846609 to 1844402)