Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1714080
End position: 1714115
Length: 36

DNA sequence
>NC_020546, from 1714080 to 1714115 (36 bp); Bifidobacterium thermophilum RBL67 GGTCGCGGTCTTGGTCGCGGTCTTGGTCGCGGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1713631-1715787	Sequence	D805_1383 - PTS system mannose-specific transporter subunit IIBCA (Protein is coded in complementary strand; from 1715787 to 1713631)