Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1705057
End position: 1705083
Length: 27

DNA sequence
>NC_020546, from 1705057 to 1705083 (27 bp); Bifidobacterium thermophilum RBL67 GTGGATTGAGTTGATTGAGTGGATTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1703317-1705185	Sequence	D805_1376 - phage shock protein C, PspC (Protein is coded in complementary strand; from 1705185 to 1703317)