Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1641498
End position: 1641521
Length: 24

DNA sequence
>NC_020546, from 1641498 to 1641521 (24 bp); Bifidobacterium thermophilum RBL67 TCGTCCTTGTCCTCGTCATCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1640022-1643645	Sequence	D805_1326 - helicase (Protein is coded in complementary strand; from 1643645 to 1640022)