Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1565555
End position: 1565581
Length: 27

DNA sequence
>NC_020546, from 1565555 to 1565581 (27 bp); Bifidobacterium thermophilum RBL67 GAATTATTCGAATTATGCGAAGTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1565096-1566556	Sequence	D805_1266 - CHAP domain containing protein (Protein is coded in complementary strand; from 1566556 to 1565096)