Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1499469
End position: 1499495
Length: 27

DNA sequence
>NC_020546, from 1499469 to 1499495 (27 bp); Bifidobacterium thermophilum RBL67 CACCACAATCACGACAATCACCACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1499281-1500498	Sequence	D805_1215 - S-layer domain protein (Protein is coded in complementary strand; from 1500498 to 1499281)