Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1404705
End position: 1404740
Length: 36

DNA sequence
>NC_020546, from 1404705 to 1404740 (36 bp); Bifidobacterium thermophilum RBL67 CCGACGGCGACGCAGACGCCGACTCAGACGCCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1404407-1405054	Sequence	D805_1134 - hypothetical protein (Protein is coded in complementary strand; from 1405054 to 1404407)