Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1348174
End position: 1348203
Length: 30

DNA sequence
>NC_020546, from 1348174 to 1348203 (30 bp); Bifidobacterium thermophilum RBL67 CGGTGTTTCGCCGTGTTACGCGGTGTGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1348202-1349167	Sequence	D805_1091 - orotidine 5'-phosphate decarboxylase (Protein is coded in complementary strand; from 1349167 to 1348202)