Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1343648
End position: 1343671
Length: 24

DNA sequence
>NC_020546, from 1343648 to 1343671 (24 bp); Bifidobacterium thermophilum RBL67 GACGGCAGGACCGCAGGACGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1343629-1344327	Sequence	D805_1086 - HAD-superfamily hydrolase, subfamily IA, variant 3