Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1331568
End position: 1331591
Length: 24

DNA sequence
>NC_020546, from 1331568 to 1331591 (24 bp); Bifidobacterium thermophilum RBL67 GATGTCGACGTCGATGCCGATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1331203-1332231	Sequence	D805_1078 - shikimate 5-dehydrogenase (Protein is coded in complementary strand; from 1332231 to 1331203)