Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1138474
End position: 1138497
Length: 24

DNA sequence
>NC_020546, from 1138474 to 1138497 (24 bp); Bifidobacterium thermophilum RBL67 CGAGGGCGTGGGCGATGGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1138086-1138565	Sequence	D805_0916 - hypothetical protein (Protein is coded in complementary strand; from 1138565 to 1138086)