Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 1069809
End position: 1069865
Length: 57

DNA sequence
>NC_020546, from 1069809 to 1069865 (57 bp); Bifidobacterium thermophilum RBL67 CCAGTCTGTCTGCCAGTCGGCAGTCCGTCTGCCAGTCGGCAGTCCGTCTGTCAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1069860-1071191	Sequence	D805_0864 - DNA-directed DNA polymerase (Protein is coded in complementary strand; from 1071191 to 1069860)