Sequence retrieval

Genome: Bifidobacterium thermophilum RBL67
Start position: 104811
End position: 104846
Length: 36

DNA sequence
>NC_020546, from 104811 to 104846 (36 bp); Bifidobacterium thermophilum RBL67 GTGCCGGGGACGGTGTCGGGGACGGTGTCGCGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 103724-104905	Sequence	D805_0085 - aromatic amino acid exporter (Protein is coded in complementary strand; from 104905 to 103724)