Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 3893598
End position: 3893624
Length: 27

DNA sequence
>NC_020507, from 3893598 to 3893624 (27 bp); Bacillus subtilis subsp. subtilis 6051-HGW GGACAGCAAGGACAACAAGGACAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3893446-3893991	Sequence	BSU6051_37920 ywdL spore coat protein YwdL