Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 3812625
End position: 3812669
Length: 45

DNA sequence
>NC_020507, from 3812625 to 3812669 (45 bp); Bacillus subtilis subsp. subtilis 6051-HGW TCGTCTTCATCAAGATCTTCTTCGTCAAAATCGTCGGCTTCAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3812547-3813068	Sequence	BSU6051_37160 rpoE RNA polymerase delta subunit RpoE (Protein is coded in complementary strand; from 3813068 to 3812547)