Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 3574809
End position: 3574844
Length: 36

DNA sequence
>NC_020507, from 3574809 to 3574844 (36 bp); Bacillus subtilis subsp. subtilis 6051-HGW CCGTTTGACGAACTGTTTGATGAACCGTTAGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3574344-3575765	Sequence	BSU6051_34800 cwlO secreted cell wall DL-endopeptidase CwlO (Protein is coded in complementary strand; from 3575765 to 3574344)