Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 3274533
End position: 3274577
Length: 45

DNA sequence
>NC_020507, from 3274533 to 3274577 (45 bp); Bacillus subtilis subsp. subtilis 6051-HGW CTGCGGCTTTTTCTTCTGCCGCTTTCTCTTCTGCTTGTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3274442-3275797	Sequence	BSU6051_31890 yukC putative membrane-associated enzyme involved in bacteriocin production YukC (Protein is coded in complementary strand; from 3275797 to 3274442)