Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 3159342
End position: 3159365
Length: 24

DNA sequence
>NC_020507, from 3159342 to 3159365 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW TCATCTTCATCCTCTTCTTCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3159240-3159671	Sequence	BSU6051_30890 ytxO YtxO (Protein is coded in complementary strand; from 3159671 to 3159240)