Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 2871396
End position: 2871419
Length: 24

DNA sequence
>NC_020507, from 2871396 to 2871419 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW CTCTTCCTCTTGTTCTTCCTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2871004-2872731	Sequence	BSU6051_28110 spoVID morphogenetic spore protein SpoVID (Protein is coded in complementary strand; from 2872731 to 2871004)