Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 2672244
End position: 2672267
Length: 24

DNA sequence
>NC_020507, from 2672244 to 2672267 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW TTCTTCTTCGTCTTTTTCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2672037-2672696	Sequence	BSU6051_26020 yqbP skin element YqbP (Protein is coded in complementary strand; from 2672696 to 2672037)