Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 2207725
End position: 2207748
Length: 24

DNA sequence
>NC_020507, from 2207725 to 2207748 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW TAATTTTTTAATTGTTTAATTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2206681-2207757	Sequence	BSU6051_20810 yopP putative phage integrase, phage SPbeta (Protein is coded in complementary strand; from 2207757 to 2206681)
ORF... 2207747-2207959	Sequence	BSU6051_20820 yopO putative transcriptional regulator, phage SPbeta (Protein is coded in complementary strand; from 2207959 to 2207747)