Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 2124195
End position: 2124230
Length: 36

DNA sequence
>NC_020507, from 2124195 to 2124230 (36 bp); Bacillus subtilis subsp. subtilis 6051-HGW CGCCAAACCTGATGCAAAACCTGATGTCAAACCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2124020-2124493	Sequence	BSU6051_19490 gerT component of the spore coat GerT