Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1692156
End position: 1692182
Length: 27

DNA sequence
>NC_020507, from 1692156 to 1692182 (27 bp); Bacillus subtilis subsp. subtilis 6051-HGW TCAAAATACTCAAAACACTCAAAATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1692128-1692448	Sequence	BSU6051_16200 fliE flagellar basal body protein FliE