Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1509712
End position: 1509735
Length: 24

DNA sequence
>NC_020507, from 1509712 to 1509735 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW GACGAAGAGGAAGAGGAAGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1509254-1511161	Sequence	BSU6051_14400 fruA phosphotransferase system (PTS) fructose-specific enzyme IIABC component FruA