Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1431334
End position: 1431363
Length: 30

DNA sequence
>NC_020507, from 1431334 to 1431363 (30 bp); Bacillus subtilis subsp. subtilis 6051-HGW AGGGTTTTTTAGTATTTTTTATGTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1431025-1431456	Sequence	BSU6051_13650 eag putative small membrane protein Eag