Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1280632
End position: 1280667
Length: 36

DNA sequence
>NC_020507, from 1280632 to 1280667 (36 bp); Bacillus subtilis subsp. subtilis 6051-HGW TAACCTCCCCCATATCCTCCGCCATAACCTCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1280623-1280946	Sequence	BSU6051_12090 cotT spore coat protein CotT (Protein is coded in complementary strand; from 1280946 to 1280623)