Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1251087
End position: 1251110
Length: 24

DNA sequence
>NC_020507, from 1251087 to 1251110 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW TTTTTCTTTATCTTTCTCTTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1250653-1251171	Sequence	BSU6051_11760 cotX spore coat protein CotX (Protein is coded in complementary strand; from 1251171 to 1250653)