Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis 6051-HGW
Start position: 1072308
End position: 1072331
Length: 24

DNA sequence
>NC_020507, from 1072308 to 1072331 (24 bp); Bacillus subtilis subsp. subtilis 6051-HGW CTTTTTTTCTATTTTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1072039-1072557	Sequence	BSU6051_09965 yhaJ putative bacteriocin YhaJ (Protein is coded in complementary strand; from 1072557 to 1072039)