Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 4533128
End position: 4533172
Length: 45

DNA sequence
>NC_020209, from 4533128 to 4533172 (45 bp); Pseudomonas poae RE*1-1-14 GCTGCGGGCTTGGCAGGTGCTGGTTTGGCAGCGGCAGGCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4533029-4534108	Sequence	H045_19940 - alginate regulatory protein AlgP (Protein is coded in complementary strand; from 4534108 to 4533029)