Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 4494368
End position: 4494391
Length: 24

DNA sequence
>NC_020209, from 4494368 to 4494391 (24 bp); Pseudomonas poae RE*1-1-14 AGCACCAGCATCACCACCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4493504-4495120	Sequence	H045_19750 - ferric iron ABC transporter, FeT family, permease protein (Protein is coded in complementary strand; from 4495120 to 4493504)