Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 4161448
End position: 4161471
Length: 24

DNA sequence
>NC_020209, from 4161448 to 4161471 (24 bp); Pseudomonas poae RE*1-1-14 ACCAGCACCAGGAACAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4160332-4161552	Sequence	H045_18215 - putative ABC transporter membrane protein (Protein is coded in complementary strand; from 4161552 to 4160332)