Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 4062608
End position: 4062632
Length: 25

DNA sequence
>NC_020209, from 4062608 to 4062632 (25 bp); Pseudomonas poae RE*1-1-14 CGCCCTGCCCCGCCGCGACCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4062532-4063497	Sequence	H045_17725 - thiamine monophosphate kinase (Protein is coded in complementary strand; from 4063497 to 4062532)