Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 4013185
End position: 4013208
Length: 24

DNA sequence
>NC_020209, from 4013185 to 4013208 (24 bp); Pseudomonas poae RE*1-1-14 ACCGCCACCGGCACCGCAGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4012663-4013808	Sequence	H045_17505 - rod shape-determining protein RodA (Protein is coded in complementary strand; from 4013808 to 4012663)